Propagation of CcpN regulog to Streptococcus agalactiae 2603V/R

Reference regulog properties
Source regulog:	CcpN - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	CcpN
Regulation mode:	repressor
Biological process:	Gluconeogenesis
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus agalactiae 2603V/R
Orthologous TF(s)	SAG1672
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Streptococcus agalactiae 2603V/R*
	Locus tag	Position	Score	Sequence
Position: -171 Score: 5.7 Sequence: ATATAATATAACATATAAAAT Locus tag: SAG1672
	SAG1672	-171	5.7	ATATAATATAACATATAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yqfL
Ortholog function: Predicted phosphotransferase
Streptococcus agalactiae 2603V/R	SAG1672	-171	5.7	ATATAATATAACATATAAAAT
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1842	-174	5.4	ATATAATGTACCATATATAAT
Streptococcus uberis 0140J	SUB1521	-44	5.9	ATATAATATACTATATAATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --