Propagation of YxeR regulog to Lactococcus lactis subsp. lactis KF147

Reference regulog properties
Source regulog:	YxeR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactococcus lactis subsp. lactis KF147
Orthologous TF(s)	LLKF_0637
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Lactococcus lactis subsp. lactis KF147*
	Locus tag	Position	Score	Sequence
Position: -41 Score: 7.1 Sequence: TAAATGACACAGTGTCATAAA Locus tag: LLKF_0637
	LLKF_0637	-41	7.1	TAAATGACACAGTGTCATAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yxeR
Ortholog function: Predicted antibiotic resistance transcriptional reguator, TetR family
Lactococcus lactis subsp. lactis Il1403	L53789	-41	7.1	TAAATGACACAGTGTCATAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --