Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PadR regulog to Lactococcus lactis subsp. lactis KF147

Reference regulog properties
Source regulog: PadR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: Ferulic acid; p-Coumaric acid
Phylum: Firmicutes
Propagated regulon:
Target genome Lactococcus lactis subsp. lactis KF147
Orthologous TF(s) LLKF_2126
Regulated genes 1
Built upon 2 sites [see more]
Predicted regulatory interactions in Lactococcus lactis subsp. lactis KF147
Locus tag Position Score Sequence
Position: 4
Score: 6.5
Sequence: AAACATTTAAAAGCTTAGAAGATT
Locus tag: LLKF_2125
LLKF_2125 4 6.5 AAACATTTAAAAGCTTAGAAGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padC
Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-)
Lactococcus lactis subsp. lactis Il1403 L193734 4 6.5 AAACATTTAAAAGCTTAGAAGATT
Streptococcus gallolyticus UCN34 GALLO_2106 7 6.4 AAACATTTAAAACTTTGGACGATT