Propagation of TreR regulog to Streptococcus pneumoniae SP3-BS71
Source regulog: | TreR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Trehalose utilization |
Effector: | Trehalose-6-phosphate |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus pneumoniae SP3-BS71 |
Orthologous TF(s) | CGSSp3BS71_03912 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -80
Score: 5.8 Sequence: ACAAGTTGCAGACAAGTTTG
Locus tag: CGSSp3BS71_03907
|
||||
CGSSp3BS71_03907 | -80 | 5.8 | ACAAGTTGCAGACAAGTTTG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: treP | ||||
Ortholog function: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) | ||||
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_2069 | -128 | 6 | ACAACTTGTAGACAAATTTG |
Streptococcus gallolyticus UCN34 | GALLO_2175 | -99 | 5.6 | ACAACTTGCAGACAAAATGG |
Streptococcus gordonii str. Challis substr. CH1 | SGO_1653 | -106 | 5.4 | ACATCTTGCATACACGTTTG |
Streptococcus mutans UA159 | SMU.2038 | -94 | 5.6 | ACAACTTGCCAACAAATTTG |
Streptococcus pneumoniae TIGR4 | SP_1884 | -80 | 5.8 | ACAAGTTGCAGACAAGTTTG |
Streptococcus pyogenes M1 GAS | SPy2097 | -128 | 6 | ACAACTTGTAGACAAATTTG |
Streptococcus sanguinis SK36 | SSA_1752 | -47 | 5.5 | ACAACTTGCATACATCTTTG |
Streptococcus uberis 0140J | SUB1763 | -135 | 5.9 | ACAACTTGCCTACAAATTTG |
Position: -124
Score: 5.8 Sequence: CAAACTTGTCTGCAACTTGT
Locus tag: CGSSp3BS71_03912
|
||||
CGSSp3BS71_03912 | -124 | 5.8 | CAAACTTGTCTGCAACTTGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: treR | ||||
Ortholog function: Trehalose utilization transcriptional regulator TreR, GntR family | ||||
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_2070 | -102 | 6 | CAAATTTGTCTACAAGTTGT |
Streptococcus gallolyticus UCN34 | GALLO_2176 | -116 | 5.6 | CCATTTTGTCTGCAAGTTGT |
Streptococcus gordonii str. Challis substr. CH1 | SGO_1654 | -93 | 5.4 | CAAACGTGTATGCAAGATGT |
Streptococcus mutans UA159 | SMU.2040 | -99 | 5.6 | CAAATTTGTTGGCAAGTTGT |
Streptococcus pneumoniae TIGR4 | SP_1885 | -124 | 5.8 | CAAACTTGTCTGCAACTTGT |
Streptococcus pyogenes M1 GAS | SPy2099 | -102 | 6 | CAAATTTGTCTACAAGTTGT |
Streptococcus sanguinis SK36 | SSA_1753 | -91 | 5.5 | CAAAGATGTATGCAAGTTGT |
Streptococcus uberis 0140J | SUB1764 | -104 | 5.9 | CAAATTTGTAGGCAAGTTGT |