Propagation of MntR regulog to Streptococcus pneumoniae SP3-BS71
Source regulog: | MntR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus pneumoniae SP3-BS71 |
Orthologous TF(s) | CGSSp3BS71_02582 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -61
Score: 6.4 Sequence: AAAATTAACTTGACTTAATTTT
Locus tag: CGSSp3BS71_02632
|
||||
CGSSp3BS71_02632 | -61 | 6.4 | AAAATTAACTTGACTTAATTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntB | ||||
Ortholog function: Manganese ABC transporter, ATP-binding protein | ||||
Lactococcus lactis subsp. lactis Il1403 | L150744 | -87 | 4.9 | CAAAATATATTGATTTAATTTT |
Streptococcus agalactiae 2603V/R | SAG1532 | -59 | 6.3 | AAAATTAAGTTAACTTAATTTA |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0489 | -51 | 6.1 | ATATTTAACTATACTTAATTAA |
Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1468 | -51 | 6.4 | ATAATTAACTATACTTAATTAA |
Streptococcus gallolyticus UCN34 | GALLO_2046 | -53 | 5.8 | AAAATTAAGCATGCTTAATTTT |
Streptococcus gordonii str. Challis substr. CH1 | SGO_1800 | -60 | 6.4 | AAAATTAACTTGACTTAATTTT |
Streptococcus mitis B6 | smi_0636 | -62 | 6.1 | AAAATTAACTTGACTTAACTTT |
Streptococcus mutans UA159 | SMU.182 | -57 | 6.4 | AAAATTAACTTGACTTAATTTT |
Streptococcus pneumoniae TIGR4 | SP_1648 | -62 | 6.4 | AAAATTAACTTGACTTAATTTT |
Streptococcus pyogenes M1 GAS | SPy0454 | -51 | 6.4 | ATAATTAACTAAACTTAATTAA |
Streptococcus sanguinis SK36 | SSA_0262 | -29 | 6.4 | AAAATTAACTTGACTTAATTTT |
Streptococcus uberis 0140J | SUB0474 | -50 | 6.1 | ATAATTAACCATACTTAATTAA |
-32 | 4.9 | TTAATTATATAATATAAATTAA | ||