Propagation of CtsR regulog to Streptococcus pneumoniae SP9-BS68
Source regulog: | CtsR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | CtsR |
Regulation mode: | repressor |
Biological process: | Heat shock response |
Effector: | Heat shock |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus pneumoniae SP9-BS68 |
Orthologous TF(s) | CGSSp9BS68_10680 |
Regulated genes | 3 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -89
Score: 6.8 Sequence: AAAAATTTGACCTTTTTTGACCAA
Locus tag: CGSSp9BS68_08312
|
||||
CGSSp9BS68_08312 | -89 | 6.8 | AAAAATTTGACCTTTTTTGACCAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: clpP | ||||
Ortholog function: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) | ||||
Lactococcus lactis subsp. cremoris SK11 | LACR_0700 | -110 | 6.8 | TTTTCTTTGACCTTTTTTGACCAA |
Lactococcus lactis subsp. lactis Il1403 | L72391 | -110 | 6.8 | TATTCTTTGACCTTTTTTGACCAA |
Streptococcus agalactiae 2603V/R | SAG1585 | -67 | 6.6 | TATTATTTGACCTTTGTTGACCAA |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0439 | -125 | 6.5 | TATCATTTGACCTTTCTTGACCAA |
Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1614 | -93 | 6.8 | TATCATTTGACCTTTTTTGACCAA |
Streptococcus gallolyticus UCN34 | GALLO_1763 | -127 | 7 | TTTTATTTGACCTTTTTTGACCAA |
Streptococcus gordonii str. Challis substr. CH1 | SGO_1632 | -103 | 6.6 | AAAAATTTGACCTTTATTGACCAA |
Streptococcus mitis B6 | smi_1417 | -89 | 6.8 | AAAAATTTGACCTTTTTTGACCAA |
Streptococcus mutans UA159 | SMU.1672 | -68 | 6.8 | AAATATTTGACCTTTTTTGACCAA |
Streptococcus pneumoniae TIGR4 | SP_0746 | -89 | 6.8 | AAAAATTTGACCTTTTTTGACCAA |
Streptococcus pyogenes M1 GAS | SPy0395 | -125 | 6.6 | TATGATTTGACCTTTATTGACCAA |
Streptococcus sanguinis SK36 | SSA_1731 | -103 | 6.6 | TTCTATTTGACCTTTTTTGACCAA |
Streptococcus suis 05ZYH33 | SSU05_1550 | -67 | 6.1 | TTTTTATTGACCAATTTTGACTAT |
Streptococcus thermophilus CNRZ1066 | str0356 | -67 | 6.2 | TTTTATTTGACCTAATTTGACTAA |
Streptococcus uberis 0140J | SUB0429 | -98 | 6.7 | TATTATTTGACCTTATTTGACCAA |
Position: -62
Score: 6.3 Sequence: TAGAATTTGACTATTTTTGACCTT
Locus tag: CGSSp9BS68_08712
|
||||
CGSSp9BS68_08712 | -62 | 6.3 | TAGAATTTGACTATTTTTGACCTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: clpE | ||||
Ortholog function: ATP-dependent Clp protease, ATP-binding subunit ClpE | ||||
Lactococcus lactis subsp. cremoris SK11 | LACR_0578 | -119 | -0.4 | ATGGTCAAATATGGTCAAGCTTTT |
Lactococcus lactis subsp. lactis Il1403 | L0221 | -117 | -0.9 | ATGGTCAAATATGGTCAAACTTTT |
Streptococcus agalactiae 2603V/R | SAG0488 | -65 | 6.3 | TAAAGTTTGACTATATTTGACTAT |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_1496 | -62 | 6.7 | TAAAGTTTGACCATTTTTGACTAA |
Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_0605 | -63 | 6.7 | TAAAGTTTGACCATTTTTGACTAA |
Streptococcus gallolyticus UCN34 | GALLO_0612 | -65 | 5.7 | TGAAGTTTGACTATCTTTGACCTT |
Streptococcus gordonii str. Challis substr. CH1 | SGO_0688 | -65 | 6.9 | TAAAGTTTGACTATTTTTGACCAA |
Streptococcus mitis B6 | smi_0865 | -62 | 6.3 | TAGAATTTGACTATTTTTGACCTT |
Streptococcus mutans UA159 | SMU.562 | -74 | 6.6 | TAAAGTTTGACCATTATTGACCAT |
Streptococcus pneumoniae TIGR4 | SP_0820 | -62 | 6.3 | TAGAATTTGACTATTTTTGACCTT |
Streptococcus pyogenes M1 GAS | SPy1509 | -62 | 6.7 | TAAAGTTTGACCATTTTTGACTAA |
Streptococcus sanguinis SK36 | SSA_0669 | -73 | 6.2 | AAAACTTTGACTATTTTTGACCTT |
Streptococcus thermophilus CNRZ1066 | str0602 | -75 | 6.5 | ATAGATTTGACCTTTTTTGACCAA |
Streptococcus uberis 0140J | SUB1281 | -61 | 6.7 | TAAAGTTTGACCATTTTTGACTAA |
Position: -102
Score: 6.1 Sequence: TTTTTCTTGATTATTTCTGACTAA
Locus tag: CGSSp9BS68_09896
|
||||
CGSSp9BS68_09896 | -102 | 6.1 | TTTTTCTTGATTATTTCTGACTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: groS | ||||
Ortholog function: Heat shock protein 60 family co-chaperone GroES | ||||
Lactococcus lactis subsp. cremoris SK11 | LACR_0439 | -95 | 5.9 | TTTCTCTTGACTAAATCTGACCAT |
Lactococcus lactis subsp. lactis Il1403 | L198515 | -96 | 5.9 | TTTCTCTTGACTAAATCTGACCAT |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_2041 | -106 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
Streptococcus gallolyticus UCN34 | GALLO_0124 | -134 | 6.8 | TTTTTCTTGACTATTTCTGACCAA |
Streptococcus gordonii str. Challis substr. CH1 | SGO_1886 | -96 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
Streptococcus mitis B6 | smi_0481 | -102 | 6.8 | TTTTTCTTGACTATTTCTGACCAA |
Streptococcus mutans UA159 | SMU.1955 | -91 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
Streptococcus pneumoniae TIGR4 | SP_1907 | -102 | 6.2 | TTTTTCTTGATTATTTCTGACCAA |
Streptococcus pyogenes M1 GAS | SPy2072 | -107 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
Streptococcus sanguinis SK36 | SSA_0225 | -97 | 6.8 | TTTTTCTTGACTATTTCTGACCAA |
Streptococcus suis 05ZYH33 | SSU05_0147 | -66 | 6.5 | ATGTTCTTGACTATTTTTGACCAA |
Streptococcus uberis 0140J | SUB1742 | -108 | 6.6 | TTTTTCTTGACTAATTTTGACCAA |