Propagation of HrcA regulog to Streptococcus pneumoniae SP9-BS68
| Source regulog: | HrcA - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus pneumoniae SP9-BS68 |
| Orthologous TF(s) | CGSSp9BS68_01523 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -57
Score: 7.6 Sequence: TTAGCACTCAGGTATAAAGAGTGCTAA
Locus tag: CGSSp9BS68_09896
|
||||
| CGSSp9BS68_09896 | -57 | 7.6 | TTAGCACTCAGGTATAAAGAGTGCTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: groS | ||||
| Ortholog function: Heat shock protein 60 family co-chaperone GroES | ||||
| Lactococcus lactis subsp. cremoris SK11 | LACR_0439 | -51 | 7.1 | TTAGCACACAACTATTAAGAGTGCTAA |
| Lactococcus lactis subsp. lactis Il1403 | L198515 | -52 | 7.9 | TTAGCACTCGTTTAATAAGAGTGCTAA |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_2041 | -61 | 7.7 | TTAGCACTCGTACAACAAGAGTGCTAA |
| Streptococcus gallolyticus UCN34 | GALLO_0124 | -86 | 7.5 | TTAGCACTCGATGTATTAGAGTGCTAA |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_1886 | -50 | 7.3 | TTAGCACTCGATAGACGAGAGTGCTAA |
| Streptococcus mitis B6 | smi_0481 | -57 | 7.7 | TTAGCACTCATCTATAAAGAGTGCTAA |
| Streptococcus mutans UA159 | SMU.1955 | -46 | 7 | TTAGCACTCAGTATATTGGAGTGCTAA |
| Streptococcus pneumoniae TIGR4 | SP_1907 | -57 | 7.6 | TTAGCACTCAAGTTCAAAGAGTGCTAA |
| Streptococcus pyogenes M1 GAS | SPy2072 | -62 | 7.1 | TTAGCCCTCGATGAACATGAGTGCTAA |
| Streptococcus sanguinis SK36 | SSA_0225 | -51 | 7.3 | TTAGCACTCGATAGTTTAGAGTGCTAA |
| Streptococcus suis 05ZYH33 | SSU05_0147 | -20 | 7.7 | TTAGCACTCGAATACAAAGAGTGCTAA |
| Streptococcus uberis 0140J | SUB1742 | -63 | 7.5 | TTGGCACTCTTTTTTAAAGAGTGCTAA |