Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CtsR regulog to Streptococcus suis P1/7

Reference regulog properties
Source regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus suis P1/7
Orthologous TF(s) SSU1767
Regulated genes 3
Built upon 68 sites [see more]
Predicted regulatory interactions in Streptococcus suis P1/7
Locus tag Position Score Sequence
Position: -93
Score: 6.5
Sequence: ATGTTCTTGACTATTTTTGACCAA
Locus tag: SSU0146
SSU0146 -93 6.5 ATGTTCTTGACTATTTTTGACCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: groS
Ortholog function: Heat shock protein 60 family co-chaperone GroES
Lactococcus lactis subsp. cremoris SK11 LACR_0439 -95 5.9 TTTCTCTTGACTAAATCTGACCAT
Lactococcus lactis subsp. lactis Il1403 L198515 -96 5.9 TTTCTCTTGACTAAATCTGACCAT
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_2041 -106 6.9 TTTTTCTTGACTATTTTTGACCAA
Streptococcus gallolyticus UCN34 GALLO_0124 -134 6.8 TTTTTCTTGACTATTTCTGACCAA
Streptococcus gordonii str. Challis substr. CH1 SGO_1886 -96 6.9 TTTTTCTTGACTATTTTTGACCAA
Streptococcus mitis B6 smi_0481 -102 6.8 TTTTTCTTGACTATTTCTGACCAA
Streptococcus mutans UA159 SMU.1955 -91 6.9 TTTTTCTTGACTATTTTTGACCAA
Streptococcus pneumoniae TIGR4 SP_1907 -102 6.2 TTTTTCTTGATTATTTCTGACCAA
Streptococcus pyogenes M1 GAS SPy2072 -107 6.9 TTTTTCTTGACTATTTTTGACCAA
Streptococcus sanguinis SK36 SSA_0225 -97 6.8 TTTTTCTTGACTATTTCTGACCAA
Streptococcus suis 05ZYH33 SSU05_0147 -66 6.5 ATGTTCTTGACTATTTTTGACCAA
Streptococcus uberis 0140J SUB1742 -108 6.6 TTTTTCTTGACTAATTTTGACCAA
Position: -254
Score: 6.1
Sequence: AAACTATTGACTTTTACTGACCAA
Locus tag: SSU0352
SSU0352 -254 6.1 AAACTATTGACTTTTACTGACCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: clpL
Ortholog function: ATP-dependent Clp protease, ATP-binding subunit
Streptococcus agalactiae 2603V/R SAG1303 -144 6.3 TATTTATTGACCTTTACTGACTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_0851 -180 6.4 TTTTGTTTGACCTTAACTGACCAA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1072 -181 6.3 TTTTGTTTGACCTTTACTGACCTT
Streptococcus gallolyticus UCN34 GALLO_1249 -190 6.6 AAATATTTGACTTTTACTGACCAA
Streptococcus mitis B6 smi_1765 -276 6.3 AAATCCTTGACCTTTTCTGACTAA
Streptococcus pneumoniae TIGR4 SP_0338 -275 6.5 AAACTCTTGACCTTTTCTGACCAA
Streptococcus pyogenes M1 GAS SPy0888 -172 6.3 TTTTGTTTGACCTTTACTGACCTT
Streptococcus suis 05ZYH33 SSU05_0389 -254 6.1 AAACTATTGACTTTTACTGACCAA
Streptococcus suis 05ZYH33 SSU05_0390 -254 6.1 AAACTATTGACTTTTACTGACCAA
Streptococcus suis 05ZYH33 SSU05_0391 -254 6.1 AAACTATTGACTTTTACTGACCAA
Streptococcus thermophilus CNRZ1066 str1614 -84 -0.1 TTGGTCAGTAAAAGTCAATTTTTA
Streptococcus uberis 0140J SUB0776 -152 6.9 TTTTTCTTGACCTTTTTTGACCAA
Position: -67
Score: 6.4
Sequence: TTTTATTTGACCAATTTTGACTAT
Locus tag: SSU1366
SSU1366 -67 6.4 TTTTATTTGACCAATTTTGACTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: clpP
Ortholog function: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Lactococcus lactis subsp. cremoris SK11 LACR_0700 -110 6.8 TTTTCTTTGACCTTTTTTGACCAA
Lactococcus lactis subsp. lactis Il1403 L72391 -110 6.8 TATTCTTTGACCTTTTTTGACCAA
Streptococcus agalactiae 2603V/R SAG1585 -67 6.6 TATTATTTGACCTTTGTTGACCAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_0439 -125 6.5 TATCATTTGACCTTTCTTGACCAA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1614 -93 6.8 TATCATTTGACCTTTTTTGACCAA
Streptococcus gallolyticus UCN34 GALLO_1763 -127 7 TTTTATTTGACCTTTTTTGACCAA
Streptococcus gordonii str. Challis substr. CH1 SGO_1632 -103 6.6 AAAAATTTGACCTTTATTGACCAA
Streptococcus mitis B6 smi_1417 -89 6.8 AAAAATTTGACCTTTTTTGACCAA
Streptococcus mutans UA159 SMU.1672 -68 6.8 AAATATTTGACCTTTTTTGACCAA
Streptococcus pneumoniae TIGR4 SP_0746 -89 6.8 AAAAATTTGACCTTTTTTGACCAA
Streptococcus pyogenes M1 GAS SPy0395 -125 6.6 TATGATTTGACCTTTATTGACCAA
Streptococcus sanguinis SK36 SSA_1731 -103 6.6 TTCTATTTGACCTTTTTTGACCAA
Streptococcus suis 05ZYH33 SSU05_1550 -67 6.1 TTTTTATTGACCAATTTTGACTAT
Streptococcus thermophilus CNRZ1066 str0356 -67 6.2 TTTTATTTGACCTAATTTGACTAA
Streptococcus uberis 0140J SUB0429 -98 6.7 TATTATTTGACCTTATTTGACCAA