Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CelR regulog to Streptococcus suis P1/7

Reference regulog properties
Source regulog: CelR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus suis P1/7
Orthologous TF(s) SSU1859
Regulated genes 1
Built upon 15 sites [see more]
Predicted regulatory interactions in Streptococcus suis P1/7
Locus tag Position Score Sequence
Position: -100
Score: 6
Sequence: TTTCCGTTGTGATACGGAAA
Locus tag: SSU1862
SSU1862 -100 6 TTTCCGTTGTGATACGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celF
Ortholog function: Alpha-galactosidase/6-phospho-beta- glucosidase
Streptococcus suis 05ZYH33 SSU05_2079 -270 6 TTTCCGTTGTGATACGGAAA
© 2009-2020 RegPrecise