Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Streptococcus uberis 0140J

Reference regulog properties
Source regulog: NiaR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus uberis 0140J
Orthologous TF(s) SUB1262
Regulated genes 1
Built upon 23 sites [see more]
Predicted regulatory interactions in Streptococcus uberis 0140J
Locus tag Position Score Sequence
Position: -58
Score: 6.3
Sequence: TACAGGTGTCTTGACACCTGTA
Locus tag: SUB1261
SUB1261 -58 6.3 TACAGGTGTCTTGACACCTGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaX
Ortholog function: Substrate-specific component NiaX of predicted niacin ECF transporter
Streptococcus agalactiae 2603V/R SAG1602 -58 6.4 TACAGGTGTCTTTACACCTGTA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1467 -59 6.1 TATAGGTGTCTTGACACTTGTA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_0638 -62 4.2 GCTAGGTGTCTTGACATCTGTC
Streptococcus gallolyticus UCN34 GALLO_0647 -191 5.8 TACAGGTGTCTTGACACCTGTG
Streptococcus gordonii str. Challis substr. CH1 SGO_1046 -32 6.2 TACTACTGTATATACACATAAA
Streptococcus mitis B6 smi_1196 -33 6.5 TACTAGTGTATATACAGTTAAA
Streptococcus mutans UA159 SMU.332 -67 6.3 AACTAGTGTCTTGACAGATGTA
Streptococcus pneumoniae TIGR4 SP_1233 20 6.2 TACTAGTGTATATGCAGTTAAA
Streptococcus pyogenes M1 GAS SPy1425 -59 5.6 TACAGGTGTCTTGATAGTTATT
Streptococcus sanguinis SK36 SSA_1348 -33 6.5 TACTAGTGTATATACAGATAAA
Streptococcus suis 05ZYH33 SSU05_2019 -173 5.8 TACAGGCGTCTTGACACCTGTA
Streptococcus thermophilus CNRZ1066 str0890 28 6.1 TACTATTGTATTTACAGAAAAA
Streptococcus uberis 0140J SUB1261 -58 6.3 TACAGGTGTCTTGACACCTGTA