Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CelR regulog to Streptococcus pneumoniae CDC1873-00

Reference regulog properties
Source regulog: CelR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pneumoniae CDC1873-00
Orthologous TF(s) SP187300_0408
Regulated genes 2
Built upon 15 sites [see more]
Predicted regulatory interactions in Streptococcus pneumoniae CDC1873-00
Locus tag Position Score Sequence
Position: -86
Score: 6.2
Sequence: TTTCCTTAACAATAAGGAAA
Locus tag: SpneCDC1_010100008451
SpneCDC1_010100008451 -86 6.2 TTTCCTTAACAATAAGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglA
Ortholog function: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Streptococcus gallolyticus UCN34 GALLO_1217 -87 5.4 TTTCCTAATAACTTAGGAAA
Streptococcus gordonii str. Challis substr. CH1 SGO_1582 -89 5.9 TTTCCGTTTCGATATGGAAA
Streptococcus pneumoniae TIGR4 SP_0303 -86 6.2 TTTCCTTAACAATAAGGAAA
Position: -125
Score: 5.7
Sequence: TTTCCATATCATTTAGGAAA
Locus tag: SpneCDC1_010100008461
SpneCDC1_010100008461 -125 5.7 TTTCCATATCATTTAGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celB
Ortholog function: Cellobiose-specific PTS, component EIIB
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1401 -83 5.5 TTGCCGTAGTGCTAAGGAAA
Streptococcus gallolyticus UCN34 GALLO_1213 -93 5.9 TTTCCTTATCAAAGAGGAAA
Streptococcus gordonii str. Challis substr. CH1 SGO_1580 -96 6.3 TTTCCGTTTCGATACGGAAA
Streptococcus mutans UA159 SMU.1600 -92 5.3 TTCCGTTTTCAATACGGAAA
Streptococcus pneumoniae TIGR4 SP_0305 -125 5.7 TTTCCATATCATTTAGGAAA
Streptococcus uberis 0140J SUB0529 -141 4.8 TTGCTTTTTTAATAGGGAAA
-100 6 TTTCCGCATCATTACGGAAA