Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RbsR2 regulog to Streptococcus pyogenes MGAS5005

Reference regulog properties
Source regulog: RbsR2 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pyogenes MGAS5005
Orthologous TF(s) M5005_Spy_1264, M5005_Spy_1265
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Streptococcus pyogenes MGAS5005
Locus tag Position Score Sequence
Position: -319
Score: 3.7
Sequence: CATAAAAAACGGTTGAACCA
Locus tag: M5005_Spy_1265
M5005_Spy_1265 -319 3.7 CATAAAAAACGGTTGAACCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbsR2
Ortholog function: Transcriptional repressor of ribose utilization RbsR2, LacI family
Lactococcus lactis subsp. cremoris SK11 LACR_1803 -66 6 AAATGAAAACGGATACAATC
Lactococcus lactis subsp. lactis Il1403 L0145 -66 6.2 TAATGAAAACGGATACAATT
Streptococcus agalactiae 2603V/R SAG0119 -38 5.4 TTGTGAAACCGTTTCCACAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1537 -67 6 AAAAGAAAACGGTTACAACA
-43 5.4 ACGTGAGAACGGTTCCACAA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_0468 -62 6.3 TTTAGAAAACGGTTACAATA
-39 5.6 ACATGAGAACGGTTCCACAA
Streptococcus pyogenes M1 GAS SPy1535 -367 3.7 CATAAAAAACGGTTGAACCA
Streptococcus uberis 0140J SUB1312 -47 6.7 TAAAGAAAACGGTTACAATA