Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of BusR regulog to Streptococcus sanguinis SK36

Reference regulog properties
Source regulog: BusR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Betaine utilization
Effector: Betaine
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus sanguinis SK36
Orthologous TF(s) SSA_0387
Regulated genes 1
Built upon 3 sites [see more]
Predicted regulatory interactions in Streptococcus sanguinis SK36
Locus tag Position Score Sequence
Position: -55
Score: 7.7
Sequence: AGTGACAACTCATTAAAATAAAAATGTAGTCACT
Locus tag: SSA_0386
SSA_0386 -55 7.7 AGTGACAACTCATTAAAATAAAAATGTAGTCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: busA
Ortholog function: Glycine betaine ABC transporter, ATP-binding protein
Lactococcus lactis subsp. cremoris SK11 LACR_1542 -155 7.9 AGTGACTACATATTGTTATTATTGAGTGGTCACT
Lactococcus lactis subsp. lactis Il1403 L74195 -155 7.9 AGTGACTACATATTGTTATTATTGAGTGGTCACT
Streptococcus sanguinis SK36 SSA_0386 -55 7.7 AGTGACAACTCATTAAAATAAAAATGTAGTCACT