Propagation of AgaR regulog to Streptococcus pneumoniae CGSP14
| Source regulog: | AgaR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | N-acetylgalactosamine utilization |
| Effector: | N-acetylgalactosamine |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus pneumoniae CGSP14 |
| Orthologous TF(s) | SPCG_0060 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -269
Score: 5.6 Sequence: TTTGTTGTTATATTAATTAT
Locus tag: SPCG_0060
|
||||
| SPCG_0060 | -269 | 5.6 | TTTGTTGTTATATTAATTAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: agaR | ||||
| Ortholog function: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family | ||||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0678 | -51 | 5.3 | TTTTTTGTTATAATAGCTAA |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_0740 | -43 | 4.7 | ATTTTTGCTATAATCGTATT |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_0042 | -107 | 5.6 | TTAATTAATATAATAACATT |
| Streptococcus mitis B6 | smi_0078 | -282 | 5.5 | TTTGTTGATATATTAAATAT |
| Streptococcus pneumoniae TIGR4 | SP_0058 | -312 | 5.6 | TTTGTTGTTATATTAATTAT |
| Streptococcus sanguinis SK36 | SSA_0052 | -98 | 5.5 | AATATTAATATAATAAATTT |
| Streptococcus suis 05ZYH33 | SSU05_0448 | -157 | 4.9 | TCTATTAATATACTAACACT |
| Streptococcus uberis 0140J | SUB0041 | -53 | 5.1 | ATTTCTGTTATAATAGTTCT |
|
Position: -56
Score: 5.6 Sequence: ATAATTAATATAACAACAAA
Locus tag: SPCG_0061
|
||||
| SPCG_0061 | -56 | 5.6 | ATAATTAATATAACAACAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: bgaC | ||||
| Ortholog function: Beta-galactosidase (EC 3.2.1.23) | ||||
| Streptococcus gordonii str. Challis substr. CH1 | SGO_0043 | -67 | 5.6 | AATGTTATTATATTAATTAA |
| Streptococcus mitis B6 | smi_0079 | -56 | 5.5 | ATATTTAATATATCAACAAA |
| Streptococcus pneumoniae TIGR4 | SP_0060 | -56 | 5.6 | ATAATTAATATAACAACAAA |
| Streptococcus sanguinis SK36 | SSA_0053 | -61 | 5.5 | AAATTTATTATATTAATATT |