Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MtlR regulog to Streptococcus pneumoniae SP19-BS75

Reference regulog properties
Source regulog: MtlR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pneumoniae SP19-BS75
Orthologous TF(s) CGSSp19BS75_01583, CGSSp19BS75_01578
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Streptococcus pneumoniae SP19-BS75
Locus tag Position Score Sequence
Position: -85
Score: 6.9
Sequence: TTTGACACAAAATCTGTGACAAA
Locus tag: CGSSp19BS75_01573
CGSSp19BS75_01573 -85 6.9 TTTGACACAAAATCTGTGACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlA
Ortholog function: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
Streptococcus gallolyticus UCN34 GALLO_0993 -87 7.2 TTTGTCACAAATTTTGTGACAAA
Streptococcus mutans UA159 SMU.1185 -149 6.6 TTTGGCAAAACTTTTGTGCCAAA
Streptococcus pneumoniae TIGR4 SP_0394 -85 6.9 TTTGACACAAAATCTGTGACAAA
Streptococcus uberis 0140J SUB0997 -89 6.7 TGTGTCACAGCTTTTGTGCCAAA