Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LACR_0766 regulog to Lactococcus lactis subsp. cremoris SK11

Reference regulog properties
Source regulog: LACR_0766 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Lactococcus lactis subsp. cremoris SK11
Orthologous TF(s) LACR_0766
Regulated genes 1
Built upon 3 sites [see more]
Predicted regulatory interactions in Lactococcus lactis subsp. cremoris SK11
Locus tag Position Score Sequence
Position: -35
Score: 6.3
Sequence: AGAGTTTAACGTTAAACTAA
Locus tag: LACR_0761
LACR_0761 -35 6.3 AGAGTTTAACGTTAAACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: LACR_0761
Ortholog function: Predicted polysaccharide ABC transporter, permease protein 1
Lactococcus lactis subsp. cremoris SK11 LACR_0761 -35 6.3 AGAGTTTAACGTTAAACTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1903 -121 6.3 TCGGTTTAACGATAAACTAA