Propagation of PadR regulog to Lactococcus lactis subsp. lactis Il1403

Reference regulog properties
Source regulog:	PadR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	Ferulic acid; p-Coumaric acid
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactococcus lactis subsp. lactis Il1403
Orthologous TF(s)	L9255
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Lactococcus lactis subsp. lactis Il1403*
	Locus tag	Position	Score	Sequence
Position: 4 Score: 6.5 Sequence: AAACATTTAAAAGCTTAGAAGATT Locus tag: L193734
	L193734	4	6.5	AAACATTTAAAAGCTTAGAAGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padC
Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-)
Lactococcus lactis subsp. lactis Il1403	L193734	4	6.5	AAACATTTAAAAGCTTAGAAGATT
Streptococcus gallolyticus UCN34	GALLO_2106	7	6.4	AAACATTTAAAACTTTGGACGATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --