Propagation of MntR regulog to Streptococcus pneumoniae ATCC 700669
| Source regulog: | MntR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus pneumoniae ATCC 700669 |
| Orthologous TF(s) | SPN23F_16390 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -62
Score: 6.4 Sequence: AAAATTAACTTGACTTAATTTT
Locus tag: SPN23F_16500
|
||||
| SPN23F_16500 | -62 | 6.4 | AAAATTAACTTGACTTAATTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntB | ||||
| Ortholog function: Manganese ABC transporter, ATP-binding protein | ||||
| Lactococcus lactis subsp. lactis Il1403 | L150744 | -87 | 4.9 | CAAAATATATTGATTTAATTTT |
| Streptococcus agalactiae 2603V/R | SAG1532 | -59 | 6.3 | AAAATTAAGTTAACTTAATTTA |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0489 | -51 | 6.1 | ATATTTAACTATACTTAATTAA |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1468 | -51 | 6.4 | ATAATTAACTATACTTAATTAA |
| Streptococcus gallolyticus UCN34 | GALLO_2046 | -53 | 5.8 | AAAATTAAGCATGCTTAATTTT |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_1800 | -60 | 6.4 | AAAATTAACTTGACTTAATTTT |
| Streptococcus mitis B6 | smi_0636 | -62 | 6.1 | AAAATTAACTTGACTTAACTTT |
| Streptococcus mutans UA159 | SMU.182 | -57 | 6.4 | AAAATTAACTTGACTTAATTTT |
| Streptococcus pneumoniae TIGR4 | SP_1648 | -62 | 6.4 | AAAATTAACTTGACTTAATTTT |
| Streptococcus pyogenes M1 GAS | SPy0454 | -51 | 6.4 | ATAATTAACTAAACTTAATTAA |
| Streptococcus sanguinis SK36 | SSA_0262 | -29 | 6.4 | AAAATTAACTTGACTTAATTTT |
| Streptococcus uberis 0140J | SUB0474 | -50 | 6.1 | ATAATTAACCATACTTAATTAA |
| -32 | 4.9 | TTAATTATATAATATAAATTAA | ||