Propagation of MalR2 regulog to Streptococcus pyogenes MGAS10750

Reference regulog properties
Source regulog:	MalR2 - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus pyogenes MGAS10750
Orthologous TF(s)	MGAS10750_Spy1153
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Streptococcus pyogenes MGAS10750*
	Locus tag	Position	Score	Sequence
Position: -105 Score: 7.3 Sequence: TAACTTAAACGTTTAAGTTT Locus tag: MGAS10750_Spy1160
	MGAS10750_Spy1160	-105	7.3	TAACTTAAACGTTTAAGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: malX
Ortholog function: Maltose/maltodextrin ABC transporter, substrate-binding protein
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1305	-151	7	CAACTTAAACGTTTAAATTA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_1266	-163	7.6	TAACTTAAACGTTTAAGTTA
Streptococcus pyogenes M1 GAS	SPy1306	-141	7.3	TAACTTAAACGTTTAAGTTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --