Propagation of SPy1285 regulog to Streptococcus pyogenes MGAS10750

Reference regulog properties
Source regulog:	SPy1285 - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus pyogenes MGAS10750
Orthologous TF(s)	MGAS10750_Spy1141
Regulated genes	1

Built upon 31 sites [see more]

Predicted regulatory interactions in *Streptococcus pyogenes MGAS10750*
	Locus tag	Position	Score	Sequence
Position: -37 Score: 6.5 Sequence: TTGTCTTATACAAATAGTACAA Locus tag: MGAS10750_Spy0734
	MGAS10750_Spy0734	-37	6.5	TTGTCTTATACAAATAGTACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SPy0836
Ortholog function: Predicted ABC transporter, periplasmic protein
Streptococcus agalactiae 2603V/R	SAG1361	-35	6.2	TTGTTCTATATTAATAATACAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_0798	-37	6.6	TTGTCTTATAAAAATAGTACAA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_1122	-37	6.2	TTGTCTTAAAAAAATAGTACAA
Streptococcus gallolyticus UCN34	GALLO_1332	-48	5.6	TTGTCTTATCGCAACAATACAA
Streptococcus mitis B6	smi_0839	-153	6.5	GTGTATTATATATCTAGTACAA
Streptococcus mutans UA159	SMU.862	-112	5.9	TTGTATTATAGCCTTAAGACAA
Streptococcus pneumoniae TIGR4	SP_0785	-129	6.5	GTGTATTATATATCTAGTACAA
Streptococcus pyogenes M1 GAS	SPy0836	-37	6.5	TTGTCTTATACAAATAGTACAA
Streptococcus suis 05ZYH33	SSU05_0513	-28	5.9	GTGTATTATATAGACAACACAA
Streptococcus uberis 0140J	SUB0736	-37	6.5	TTGTCTTATATTAATAATACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --