Propagation of CelR regulog to Streptococcus pyogenes MGAS10750

Reference regulog properties
Source regulog:	CelR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus pyogenes MGAS10750
Orthologous TF(s)	MGAS10750_Spy1176
Regulated genes	1

Built upon 15 sites [see more]

Predicted regulatory interactions in *Streptococcus pyogenes MGAS10750*
	Locus tag	Position	Score	Sequence
Position: -78 Score: 5.8 Sequence: TTTCCGTGATGATAAGGAAA Locus tag: MGAS10750_Spy1178
	MGAS10750_Spy1178	-78	5.8	TTTCCGTGATGATAAGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglA
Ortholog function: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Streptococcus pyogenes M1 GAS	SPy1328	-102	5.8	TTTCCGTGATGATAAGGAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --