Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SPy1285 regulog to Streptococcus pyogenes MGAS9429

Reference regulog properties
Source regulog: SPy1285 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pyogenes MGAS9429
Orthologous TF(s) MGAS9429_Spy1095
Regulated genes 1
Built upon 31 sites [see more]
Predicted regulatory interactions in Streptococcus pyogenes MGAS9429
Locus tag Position Score Sequence
Position: -37
Score: 6.5
Sequence: TTGTCTTATACAAATAGTACAA
Locus tag: MGAS9429_Spy0700
MGAS9429_Spy0700 -37 6.5 TTGTCTTATACAAATAGTACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SPy0836
Ortholog function: Predicted ABC transporter, periplasmic protein
Streptococcus agalactiae 2603V/R SAG1361 -35 6.2 TTGTTCTATATTAATAATACAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_0798 -37 6.6 TTGTCTTATAAAAATAGTACAA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1122 -37 6.2 TTGTCTTAAAAAAATAGTACAA
Streptococcus gallolyticus UCN34 GALLO_1332 -48 5.6 TTGTCTTATCGCAACAATACAA
Streptococcus mitis B6 smi_0839 -153 6.5 GTGTATTATATATCTAGTACAA
Streptococcus mutans UA159 SMU.862 -112 5.9 TTGTATTATAGCCTTAAGACAA
Streptococcus pneumoniae TIGR4 SP_0785 -129 6.5 GTGTATTATATATCTAGTACAA
Streptococcus pyogenes M1 GAS SPy0836 -37 6.5 TTGTCTTATACAAATAGTACAA
Streptococcus suis 05ZYH33 SSU05_0513 -28 5.9 GTGTATTATATAGACAACACAA
Streptococcus uberis 0140J SUB0736 -37 6.5 TTGTCTTATATTAATAATACAA