Propagation of PflR regulog to Streptococcus pyogenes MGAS9429
| Source regulog: | PflR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Formate metabolism |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus pyogenes MGAS9429 |
| Orthologous TF(s) | MGAS9429_Spy1758 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -6
Score: 5.8 Sequence: TCGTAATTGATTTATTTACGT
Locus tag: MGAS9429_Spy1759
|
||||
| MGAS9429_Spy1759 | -6 | 5.8 | TCGTAATTGATTTATTTACGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pflA | ||||
| Ortholog function: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) | ||||
| Streptococcus agalactiae 2603V/R | SAG0325 | -59 | 4.8 | TCGTAATTGACTTTGTTACGT |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0169 | -63 | 5.8 | TCGTAATTGATTTATTTACGT |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1815 | 34 | 5.8 | TCGTAATTGATTTATTTACGT |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_1794 | -60 | 5.2 | TCGTAATTGTATTTATTGCGT |
| Streptococcus mutans UA159 | SMU.490 | -66 | 5.1 | TCGTAATTGATTTTGTTTCGT |
| Streptococcus pneumoniae TIGR4 | SP_0245 | -60 | 5.2 | TCGTAATTGTTTTTCTTTCGT |
| Streptococcus pyogenes M1 GAS | SPy2055 | -63 | 5.8 | TCGTAATTGATTTATTTACGT |
| Streptococcus sanguinis SK36 | SSA_0277 | -33 | 4.9 | TCGTAATTGTTTTTCTTTCTA |
| Streptococcus suis 05ZYH33 | SSU05_0705 | -61 | 5 | TCGTAATTGTAAAACTTTCTT |
| Streptococcus uberis 0140J | SUB0156 | -61 | 5.9 | ACGTAATTGATTTATTTACGT |