Propagation of YxeR regulog to Lactococcus lactis subsp. cremoris MG1363
| Source regulog: | YxeR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactococcus lactis subsp. cremoris MG1363 |
| Orthologous TF(s) | llmg_0626 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -40
Score: 7.1 Sequence: TAAATGACACAGTGTCATAAA
Locus tag: llmg_0626
|
||||
| llmg_0626 | -40 | 7.1 | TAAATGACACAGTGTCATAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yxeR | ||||
| Ortholog function: Predicted antibiotic resistance transcriptional reguator, TetR family | ||||
| Lactococcus lactis subsp. lactis Il1403 | L53789 | -41 | 7.1 | TAAATGACACAGTGTCATAAA |