Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Lactococcus lactis subsp. cremoris MG1363

Reference regulog properties
Source regulog: MntR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Lactococcus lactis subsp. cremoris MG1363
Orthologous TF(s) llmg_1224
Regulated genes 1
Built upon 37 sites [see more]
Predicted regulatory interactions in Lactococcus lactis subsp. cremoris MG1363
Locus tag Position Score Sequence
Position: -31
Score: 5.1
Sequence: ATAATTAAATGGAGAAAAGTAA
Locus tag: llmg_1224
llmg_1224 -31 5.1 ATAATTAAATGGAGAAAAGTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family
Lactococcus lactis subsp. cremoris SK11 LACR_1369 -31 5.1 ATAATTAAATGGAGAAAAGTAA
Lactococcus lactis subsp. lactis Il1403 L84767 -31 5.1 ATAATTAAATCAAGAAAAGTAA
Streptococcus agalactiae 2603V/R SAG1534 -151 5.1 AAAATTAATATAAGTTATGTAT
-129 6.2 TAAATTAAGTTAACTTAATTTT
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_0487 -116 6 TTAATTAAGTATAGTTAAATAT
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1470 -116 6.2 TTAATTAAGTATAGTTAATTAT
Streptococcus pyogenes M1 GAS SPy0450 -116 6.3 TTAATTAAGTTTAGTTAATTAT
Streptococcus uberis 0140J SUBp03 -117 5.9 TTAATTAAGTATGGTTAATTAT