Propagation of MtlR regulog to Streptococcus gallolyticus UCN34

Reference regulog properties
Source regulog:	MtlR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannitol utilization
Effector:	MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus gallolyticus UCN34
Orthologous TF(s)	GALLO_0994
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Streptococcus gallolyticus UCN34*
	Locus tag	Position	Score	Sequence
Position: -87 Score: 7.2 Sequence: TTTGTCACAAATTTTGTGACAAA Locus tag: GALLO_0993
	GALLO_0993	-87	7.2	TTTGTCACAAATTTTGTGACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlA
Ortholog function: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
Streptococcus gallolyticus UCN34	GALLO_0993	-87	7.2	TTTGTCACAAATTTTGTGACAAA
Streptococcus mutans UA159	SMU.1185	-149	6.6	TTTGGCAAAACTTTTGTGCCAAA
Streptococcus pneumoniae TIGR4	SP_0394	-85	6.9	TTTGACACAAAATCTGTGACAAA
Streptococcus uberis 0140J	SUB0997	-89	6.7	TGTGTCACAGCTTTTGTGCCAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --