Propagation of CtsR regulog to Streptococcus suis 05ZYH33
| Source regulog: | CtsR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CtsR |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus suis 05ZYH33 |
| Orthologous TF(s) | SSU05_1976 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -66
Score: 6.5 Sequence: ATGTTCTTGACTATTTTTGACCAA
Locus tag: SSU05_0147
|
||||
| SSU05_0147 | -66 | 6.5 | ATGTTCTTGACTATTTTTGACCAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: groS | ||||
| Ortholog function: Heat shock protein 60 family co-chaperone GroES | ||||
| Lactococcus lactis subsp. cremoris SK11 | LACR_0439 | -95 | 5.9 | TTTCTCTTGACTAAATCTGACCAT |
| Lactococcus lactis subsp. lactis Il1403 | L198515 | -96 | 5.9 | TTTCTCTTGACTAAATCTGACCAT |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_2041 | -106 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
| Streptococcus gallolyticus UCN34 | GALLO_0124 | -134 | 6.8 | TTTTTCTTGACTATTTCTGACCAA |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_1886 | -96 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
| Streptococcus mitis B6 | smi_0481 | -102 | 6.8 | TTTTTCTTGACTATTTCTGACCAA |
| Streptococcus mutans UA159 | SMU.1955 | -91 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
| Streptococcus pneumoniae TIGR4 | SP_1907 | -102 | 6.2 | TTTTTCTTGATTATTTCTGACCAA |
| Streptococcus pyogenes M1 GAS | SPy2072 | -107 | 6.9 | TTTTTCTTGACTATTTTTGACCAA |
| Streptococcus sanguinis SK36 | SSA_0225 | -97 | 6.8 | TTTTTCTTGACTATTTCTGACCAA |
| Streptococcus suis 05ZYH33 | SSU05_0147 | -66 | 6.5 | ATGTTCTTGACTATTTTTGACCAA |
| Streptococcus uberis 0140J | SUB1742 | -108 | 6.6 | TTTTTCTTGACTAATTTTGACCAA |
|
Position: -254
Score: 6.1 Sequence: AAACTATTGACTTTTACTGACCAA
Locus tag: SSU05_0389
|
||||
| SSU05_0389 | -254 | 6.1 | AAACTATTGACTTTTACTGACCAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: clpL | ||||
| Ortholog function: ATP-dependent Clp protease, ATP-binding subunit | ||||
| Streptococcus agalactiae 2603V/R | SAG1303 | -144 | 6.3 | TATTTATTGACCTTTACTGACTAA |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0851 | -180 | 6.4 | TTTTGTTTGACCTTAACTGACCAA |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1072 | -181 | 6.3 | TTTTGTTTGACCTTTACTGACCTT |
| Streptococcus gallolyticus UCN34 | GALLO_1249 | -190 | 6.6 | AAATATTTGACTTTTACTGACCAA |
| Streptococcus mitis B6 | smi_1765 | -276 | 6.3 | AAATCCTTGACCTTTTCTGACTAA |
| Streptococcus pneumoniae TIGR4 | SP_0338 | -275 | 6.5 | AAACTCTTGACCTTTTCTGACCAA |
| Streptococcus pyogenes M1 GAS | SPy0888 | -172 | 6.3 | TTTTGTTTGACCTTTACTGACCTT |
| Streptococcus suis 05ZYH33 | SSU05_0389 | -254 | 6.1 | AAACTATTGACTTTTACTGACCAA |
| Streptococcus suis 05ZYH33 | SSU05_0390 | -254 | 6.1 | AAACTATTGACTTTTACTGACCAA |
| Streptococcus suis 05ZYH33 | SSU05_0391 | -254 | 6.1 | AAACTATTGACTTTTACTGACCAA |
| Streptococcus thermophilus CNRZ1066 | str1614 | -84 | -0.1 | TTGGTCAGTAAAAGTCAATTTTTA |
| Streptococcus uberis 0140J | SUB0776 | -152 | 6.9 | TTTTTCTTGACCTTTTTTGACCAA |
|
Position: -67
Score: 6.1 Sequence: TTTTTATTGACCAATTTTGACTAT
Locus tag: SSU05_1551
|
||||
| SSU05_1551 | -67 | 6.1 | TTTTTATTGACCAATTTTGACTAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: clpP | ||||
| Ortholog function: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) | ||||
| Streptococcus suis 05ZYH33 | SSU05_1551 | -67 | 6.1 | TTTTTATTGACCAATTTTGACTAT |