Propagation of SPy1285 regulog to Streptococcus pyogenes MGAS10394
Source regulog: | SPy1285 - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Transport |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus pyogenes MGAS10394 |
Orthologous TF(s) | M6_Spy0978 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -37
Score: 6.5 Sequence: TTGTCTTATACAAATAGTACAA
Locus tag: M6_Spy0663
|
||||
M6_Spy0663 | -37 | 6.5 | TTGTCTTATACAAATAGTACAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: SPy0836 | ||||
Ortholog function: Predicted ABC transporter, periplasmic protein | ||||
Streptococcus agalactiae 2603V/R | SAG1361 | -35 | 6.2 | TTGTTCTATATTAATAATACAA |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0798 | -37 | 6.6 | TTGTCTTATAAAAATAGTACAA |
Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1122 | -37 | 6.2 | TTGTCTTAAAAAAATAGTACAA |
Streptococcus gallolyticus UCN34 | GALLO_1332 | -48 | 5.6 | TTGTCTTATCGCAACAATACAA |
Streptococcus mitis B6 | smi_0839 | -153 | 6.5 | GTGTATTATATATCTAGTACAA |
Streptococcus mutans UA159 | SMU.862 | -112 | 5.9 | TTGTATTATAGCCTTAAGACAA |
Streptococcus pneumoniae TIGR4 | SP_0785 | -129 | 6.5 | GTGTATTATATATCTAGTACAA |
Streptococcus pyogenes M1 GAS | SPy0836 | -37 | 6.5 | TTGTCTTATACAAATAGTACAA |
Streptococcus suis 05ZYH33 | SSU05_0513 | -28 | 5.9 | GTGTATTATATAGACAACACAA |
Streptococcus uberis 0140J | SUB0736 | -37 | 6.5 | TTGTCTTATATTAATAATACAA |