Propagation of RbsR2 regulog to Streptococcus pyogenes MGAS6180

Reference regulog properties
Source regulog:	RbsR2 - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus pyogenes MGAS6180
Orthologous TF(s)	M28_Spy1203
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Streptococcus pyogenes MGAS6180*
	Locus tag	Position	Score	Sequence
Position: -319 Score: 4.1 Sequence: ATAAAAAAACGGTTGAACCA Locus tag: M28_Spy1203
	M28_Spy1203	-319	4.1	ATAAAAAAACGGTTGAACCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbsR2
Ortholog function: Transcriptional repressor of ribose utilization RbsR2, LacI family
Lactococcus lactis subsp. cremoris SK11	LACR_1803	-66	6	AAATGAAAACGGATACAATC
Lactococcus lactis subsp. lactis Il1403	L0145	-66	6.2	TAATGAAAACGGATACAATT
Streptococcus agalactiae 2603V/R	SAG0119	-38	5.4	TTGTGAAACCGTTTCCACAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1537	-67	6	AAAAGAAAACGGTTACAACA
		-43	5.4	ACGTGAGAACGGTTCCACAA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_0468	-62	6.3	TTTAGAAAACGGTTACAATA
		-39	5.6	ACATGAGAACGGTTCCACAA
Streptococcus pyogenes M1 GAS	SPy1535	-367	3.7	CATAAAAAACGGTTGAACCA
Streptococcus uberis 0140J	SUB1312	-47	6.7	TAAAGAAAACGGTTACAATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --