Propagation of MntR regulog to Streptococcus agalactiae CJB111

Reference regulog properties
Source regulog:	MntR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus agalactiae CJB111
Orthologous TF(s)	SAM_1493
Regulated genes	2

Built upon 37 sites [see more]

Predicted regulatory interactions in *Streptococcus agalactiae CJB111*
	Locus tag	Position	Score	Sequence
Position: -85 Score: 5.5 Sequence: ATTATTAAGTAGCGTTAATTTT Locus tag: SAM_0767
	SAM_0767	-85	5.5	ATTATTAAGTAGCGTTAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Streptococcus agalactiae 2603V/R	SAG0745	-85	5.5	ATTATTAAGTAGCGTTAATTTT
Streptococcus gallolyticus UCN34	GALLO_0590	-78	5.2	TTAATTAAATACGCTTTATTTT
Streptococcus mitis B6	smi_1232	-164	5.2	AAAATTAACCAATATTAATAAT

Position: -56 Score: 5.3 Sequence: TTAATTAAGTTTGCTTAAAAAA Locus tag: SAM_1480
	SAM_1480	-56	5.3	TTAATTAAGTTTGCTTAAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nikA
Ortholog function: Nickel ABC transporter, substrate-binding protein
Streptococcus agalactiae 2603V/R	SAG1518	-56	5.2	CTAATTAAGTTTGCTTAAAAAA
		-34	5.2	ATAATTAACTAAACTTAAAAGA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_1456	-79	5.9	TAAATTAACCATACTTAATTTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --