Propagation of RegR regulog to Streptococcus agalactiae COH1

Reference regulog properties
Source regulog:	RegR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Hyaluronate utilization
Effector:	Hyaluronate oligosaccharide phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus agalactiae COH1
Orthologous TF(s)	SAN_1989
Regulated genes	1

Built upon 27 sites [see more]

Predicted regulatory interactions in *Streptococcus agalactiae COH1*
	Locus tag	Position	Score	Sequence
Position: -41 Score: 5 Sequence: AGGAAAAACCGGTTTACAAT Locus tag: SAN_1326
	SAN_1326	-41	5	AGGAAAAACCGGTTTACAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hyl
Ortholog function: Hyaluronate lyase precursor (EC 4.2.2.1)
Streptococcus agalactiae 2603V/R	SAG1197	-42	5	AGGAAAAACCGGTTTACAAT
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_0654	-74	5.1	TGACAAAACTAGTTTACTTT
		-45	6.1	TTGGTAAACAGGTTTACTTA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_1299	-293	5.3	TTAGTTTACCGGTTTACTTA
		-45	6.1	TTGGTAAACAGGTTTACTTA
Streptococcus pneumoniae TIGR4	SP_0314	-89	6.2	TAATTAAACCGGTTTACTTA
Streptococcus pyogenes M1 GAS	SPy1032	-54	5.5	TTAGTAAATCAATTTACTTT
Streptococcus suis 05ZYH33	SSU05_1215	-33	4.9	TAGGTAAACCGGTAAAGTTA
Streptococcus suis 05ZYH33	SSU05_1214	-33	4.9	TAGGTAAACCGGTAAAGTTA
Streptococcus suis 05ZYH33	SSU05_1213	-33	4.9	TAGGTAAACCGGTAAAGTTA
Streptococcus suis 05ZYH33	SSU05_1212	-33	4.9	TAGGTAAACCGGTAAAGTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --