Propagation of YisR regulog to Geobacillus kaustophilus HTA426

Reference regulog properties
Source regulog:	YisR - Bacillales
Regulator type:	Transcription factor
Regulator family:	AraC
Regulation mode:	activator
Biological process:	Metabolite transport
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Geobacillus kaustophilus HTA426
Orthologous TF(s)	GK0702
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Geobacillus kaustophilus HTA426*
	Locus tag	Position	Score	Sequence
Position: -34 Score: 5.4 Sequence: TCAAGTCGGAATTTGAAAAA Locus tag: GK0701
	GK0701	-34	5.4	TCAAGTCGGAATTTGAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yisQ
Ortholog function: Na+-driven multidrug efflux pump, MATE family
Bacillus subtilis subsp. subtilis str. 168	BSU10820	-106	7.1	TTAAGTCGGATTTTTACAAG
Bacillus amyloliquefaciens FZB42	RBAM_010970	-105	7	TTAAGTCGGATTTTTGCAAG
Bacillus pumilus SAFR-032	BPUM_1013	-100	6.7	TGAAGTCGGATTTCTCCAAT
Bacillus licheniformis DSM 13	BLi01177	-103	6.9	TCAAGTCGGATTTCTCCAAG
Anoxybacillus flavithermus WK1	Aflv_2194	-101	6.3	TTAAGTCGGAAATGTACAAA
Geobacillus kaustophilus HTA426	GK0701	-34	5.4	TCAAGTCGGAATTTGAAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --