Propagation of YisR regulog to Geobacillus kaustophilus HTA426
| Source regulog: | YisR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | AraC |
| Regulation mode: | activator |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Geobacillus kaustophilus HTA426 |
| Orthologous TF(s) | GK0702 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -34
Score: 5.4 Sequence: TCAAGTCGGAATTTGAAAAA
Locus tag: GK0701
|
||||
| GK0701 | -34 | 5.4 | TCAAGTCGGAATTTGAAAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yisQ | ||||
| Ortholog function: Na+-driven multidrug efflux pump, MATE family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU10820 | -106 | 7.1 | TTAAGTCGGATTTTTACAAG |
| Bacillus amyloliquefaciens FZB42 | RBAM_010970 | -105 | 7 | TTAAGTCGGATTTTTGCAAG |
| Bacillus pumilus SAFR-032 | BPUM_1013 | -100 | 6.7 | TGAAGTCGGATTTCTCCAAT |
| Bacillus licheniformis DSM 13 | BLi01177 | -103 | 6.9 | TCAAGTCGGATTTCTCCAAG |
| Anoxybacillus flavithermus WK1 | Aflv_2194 | -101 | 6.3 | TTAAGTCGGAAATGTACAAA |
| Geobacillus kaustophilus HTA426 | GK0701 | -34 | 5.4 | TCAAGTCGGAATTTGAAAAA |