Propagation of SPy1285 regulog to Streptococcus agalactiae 18RS21
| Source regulog: | SPy1285 - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Transport |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus agalactiae 18RS21 |
| Orthologous TF(s) | SAJ_0978 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -35
Score: 6.2 Sequence: TTGTTCTATATTAATAATACAA
Locus tag: SAJ_1372
|
||||
| SAJ_1372 | -35 | 6.2 | TTGTTCTATATTAATAATACAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: SPy0836 | ||||
| Ortholog function: Predicted ABC transporter, periplasmic protein | ||||
| Streptococcus agalactiae 2603V/R | SAG1361 | -35 | 6.2 | TTGTTCTATATTAATAATACAA |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0798 | -37 | 6.6 | TTGTCTTATAAAAATAGTACAA |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1122 | -37 | 6.2 | TTGTCTTAAAAAAATAGTACAA |
| Streptococcus gallolyticus UCN34 | GALLO_1332 | -48 | 5.6 | TTGTCTTATCGCAACAATACAA |
| Streptococcus mitis B6 | smi_0839 | -153 | 6.5 | GTGTATTATATATCTAGTACAA |
| Streptococcus mutans UA159 | SMU.862 | -112 | 5.9 | TTGTATTATAGCCTTAAGACAA |
| Streptococcus pneumoniae TIGR4 | SP_0785 | -129 | 6.5 | GTGTATTATATATCTAGTACAA |
| Streptococcus pyogenes M1 GAS | SPy0836 | -37 | 6.5 | TTGTCTTATACAAATAGTACAA |
| Streptococcus suis 05ZYH33 | SSU05_0513 | -28 | 5.9 | GTGTATTATATAGACAACACAA |
| Streptococcus uberis 0140J | SUB0736 | -37 | 6.5 | TTGTCTTATATTAATAATACAA |