Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PflR regulog to Streptococcus suis BM407

Reference regulog properties
Source regulog: PflR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Formate metabolism
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus suis BM407
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 28 sites [see more]
Predicted regulatory interactions in Streptococcus suis BM407
Locus tag Position Score Sequence
Position: -61
Score: 5
Sequence: TCGTAATTGTAAAACTTTCTT
Locus tag: SSUBM407_1170
SSUBM407_1170 -61 5 TCGTAATTGTAAAACTTTCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pflA
Ortholog function: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Streptococcus agalactiae 2603V/R SAG0325 -59 4.8 TCGTAATTGACTTTGTTACGT
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_0169 -63 5.8 TCGTAATTGATTTATTTACGT
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1815 34 5.8 TCGTAATTGATTTATTTACGT
Streptococcus gordonii str. Challis substr. CH1 SGO_1794 -60 5.2 TCGTAATTGTATTTATTGCGT
Streptococcus mutans UA159 SMU.490 -66 5.1 TCGTAATTGATTTTGTTTCGT
Streptococcus pneumoniae TIGR4 SP_0245 -60 5.2 TCGTAATTGTTTTTCTTTCGT
Streptococcus pyogenes M1 GAS SPy2055 -63 5.8 TCGTAATTGATTTATTTACGT
Streptococcus sanguinis SK36 SSA_0277 -33 4.9 TCGTAATTGTTTTTCTTTCTA
Streptococcus suis 05ZYH33 SSU05_0705 -61 5 TCGTAATTGTAAAACTTTCTT
Streptococcus uberis 0140J SUB0156 -61 5.9 ACGTAATTGATTTATTTACGT