Propagation of SdpR regulog to Bacillus megaterium QM B1551
Source regulog: | SdpR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Toxin-antitoxin system |
Effector: | SdpI, signal transduction protein |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus megaterium QM B1551 |
Orthologous TF(s) | BMQ_1080 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -48
Score: 6.8 Sequence: ATTTAGATAATTATCTAAAT
Locus tag: BMQ_1080
|
||||
BMQ_1080 | -48 | 6.8 | ATTTAGATAATTATCTAAAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: sdpR | ||||
Ortholog function: Transcriptional regulator of SdpC resistance operon | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU33790 | -53 | 6.2 | ATTTATACAAATATCTAAAT |
Bacillus licheniformis DSM 13 | BLi00787 | -42 | 6.3 | ATTTAGTTAAATAACTAAAT |
Anoxybacillus flavithermus WK1 | Aflv_1587 | -71 | 6.1 | AATTAGAAATTTGTCTAAAT |
-32 | 6.4 | ATTTAGAAATTTGTCTAAAT | ||
Geobacillus kaustophilus HTA426 | GK2134 | -148 | 5.4 | ATTTAGATGTTTTTCTAAAC |
Bacillus cereus ATCC 14579 | BC4834 | -47 | 6.1 | GTTTAGATAAATATCTAAAT |
Bacillus halodurans C-125 | BH0945 | -42 | 5.9 | ATTTAAGTAATTGCTTAAAT |
Paenibacillus sp. JDR-2 | Pjdr2_5471 | -54 | 6.4 | ATTTAGAATATTATCTAAAT |