Propagation of CelR regulog to Streptococcus gordonii str. Challis substr. CH1

Reference regulog properties
Source regulog:	CelR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus gordonii str. Challis substr. CH1
Orthologous TF(s)	SGO_1579
Regulated genes	2

Built upon 15 sites [see more]

Predicted regulatory interactions in *Streptococcus gordonii str. Challis substr. CH1*
	Locus tag	Position	Score	Sequence
Position: -96 Score: 6.3 Sequence: TTTCCGTTTCGATACGGAAA Locus tag: SGO_1580
	SGO_1580	-96	6.3	TTTCCGTTTCGATACGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celB
Ortholog function: Cellobiose-specific PTS, component EIIB
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1401	-83	5.5	TTGCCGTAGTGCTAAGGAAA
Streptococcus gallolyticus UCN34	GALLO_1213	-93	5.9	TTTCCTTATCAAAGAGGAAA
Streptococcus gordonii str. Challis substr. CH1	SGO_1580	-96	6.3	TTTCCGTTTCGATACGGAAA
Streptococcus mutans UA159	SMU.1600	-92	5.3	TTCCGTTTTCAATACGGAAA
Streptococcus pneumoniae TIGR4	SP_0305	-125	5.7	TTTCCATATCATTTAGGAAA
Streptococcus uberis 0140J	SUB0529	-141	4.8	TTGCTTTTTTAATAGGGAAA
		-100	6	TTTCCGCATCATTACGGAAA

Position: -89 Score: 5.9 Sequence: TTTCCGTTTCGATATGGAAA Locus tag: SGO_1582
	SGO_1582	-89	5.9	TTTCCGTTTCGATATGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglA
Ortholog function: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Streptococcus gallolyticus UCN34	GALLO_1217	-87	5.4	TTTCCTAATAACTTAGGAAA
Streptococcus gordonii str. Challis substr. CH1	SGO_1582	-89	5.9	TTTCCGTTTCGATATGGAAA
Streptococcus pneumoniae TIGR4	SP_0303	-86	6.2	TTTCCTTAACAATAAGGAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --