Propagation of AgaR regulog to Streptococcus suis SC84

Reference regulog properties
Source regulog:	AgaR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	N-acetylgalactosamine utilization
Effector:	N-acetylgalactosamine
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus suis SC84
Orthologous TF(s)	SSUSC84_0386
Regulated genes	2

Built upon 16 sites [see more]

Predicted regulatory interactions in *Streptococcus suis SC84*
	Locus tag	Position	Score	Sequence
Position: -178 Score: 4.9 Sequence: TCTATTAATATACTAACACT Locus tag: SSUSC84_0386
	SSUSC84_0386	-178	4.9	TCTATTAATATACTAACACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: agaR
Ortholog function: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_0678	-51	5.3	TTTTTTGTTATAATAGCTAA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_0740	-43	4.7	ATTTTTGCTATAATCGTATT
Streptococcus gordonii str. Challis substr. CH1	SGO_0042	-107	5.6	TTAATTAATATAATAACATT
Streptococcus mitis B6	smi_0078	-282	5.5	TTTGTTGATATATTAAATAT
Streptococcus pneumoniae TIGR4	SP_0058	-312	5.6	TTTGTTGTTATATTAATTAT
Streptococcus sanguinis SK36	SSA_0052	-98	5.5	AATATTAATATAATAAATTT
Streptococcus suis 05ZYH33	SSU05_0448	-157	4.9	TCTATTAATATACTAACACT
Streptococcus uberis 0140J	SUB0041	-53	5.1	ATTTCTGTTATAATAGTTCT

Position: -48 Score: 4.9 Sequence: AGTGTTAGTATATTAATAGA Locus tag: SSUSC84_0387
	SSUSC84_0387	-48	4.9	AGTGTTAGTATATTAATAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bgaC
Ortholog function: Beta-galactosidase (EC 3.2.1.23)
Streptococcus suis 05ZYH33	SSU05_0449	-48	4.9	AGTGTTAGTATATTAATAGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --