Propagation of CelR regulog to Streptococcus suis SC84
| Source regulog: | CelR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus suis SC84 |
| Orthologous TF(s) | SSUSC84_1881 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -100
Score: 6 Sequence: TTTCCGTTGTGATACGGAAA
Locus tag: SSUSC84_1884
|
||||
| SSUSC84_1884 | -100 | 6 | TTTCCGTTGTGATACGGAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: celF | ||||
| Ortholog function: Alpha-galactosidase/6-phospho-beta- glucosidase | ||||
| Streptococcus suis 05ZYH33 | SSU05_2079 | -270 | 6 | TTTCCGTTGTGATACGGAAA |