Propagation of CelR regulog to Streptococcus suis SC84

Reference regulog properties
Source regulog:	CelR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus suis SC84
Orthologous TF(s)	SSUSC84_1881
Regulated genes	1

Built upon 15 sites [see more]

Predicted regulatory interactions in *Streptococcus suis SC84*
	Locus tag	Position	Score	Sequence
Position: -100 Score: 6 Sequence: TTTCCGTTGTGATACGGAAA Locus tag: SSUSC84_1884
	SSUSC84_1884	-100	6	TTTCCGTTGTGATACGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celF
Ortholog function: Alpha-galactosidase/6-phospho-beta- glucosidase
Streptococcus suis 05ZYH33	SSU05_2079	-270	6	TTTCCGTTGTGATACGGAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --