Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MalR2 regulog to Streptococcus pyogenes M1 GAS

Reference regulog properties
Source regulog: MalR2 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pyogenes M1 GAS
Orthologous TF(s) SPy1297
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Streptococcus pyogenes M1 GAS
Locus tag Position Score Sequence
Position: -141
Score: 7.3
Sequence: TAACTTAAACGTTTAAGTTT
Locus tag: SPy1306
SPy1306 -141 7.3 TAACTTAAACGTTTAAGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: malX
Ortholog function: Maltose/maltodextrin ABC transporter, substrate-binding protein
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1305 -151 7 CAACTTAAACGTTTAAATTA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1266 -163 7.6 TAACTTAAACGTTTAAGTTA
Streptococcus pyogenes M1 GAS SPy1306 -141 7.3 TAACTTAAACGTTTAAGTTT