Propagation of CzcR2 regulog to Lactobacillus rhamnosus HN001

Reference regulog properties
Source regulog:	CzcR2 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:
Biological process:	Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus rhamnosus HN001
Orthologous TF(s)	LRH_07893
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Lactobacillus rhamnosus HN001*
	Locus tag	Position	Score	Sequence
Position: -101 Score: 6 Sequence: TTATGTTGACATTAACATAT Locus tag: LRH_07898
	LRH_07898	-101	6	TTATGTTGACATTAACATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: czcX
Ortholog function: Predicted cobalt-zinc-cadmium resistance protein
Lactobacillus rhamnosus GG	LGG_02417	-68	6	TTATGTTGACATTAACATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --