Propagation of YtrA regulog to Lactobacillus rhamnosus HN001
| Source regulog: | YtrA - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus rhamnosus HN001 |
| Orthologous TF(s) | LRH_08648 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -46
Score: 6.7 Sequence: GTGTACTGCGTATAATAGTACAC
Locus tag: LRH_08648
|
||||
| LRH_08648 | -46 | 6.7 | GTGTACTGCGTATAATAGTACAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ytrA | ||||
| Ortholog function: Predicted transcriptional regulator, GntR family | ||||
| Lactobacillus brevis ATCC 367 | LVIS_0408 | -60 | 6.7 | GTGTACTAGGTATAATAGTACAG |
| Lactobacillus plantarum WCFS1 | lp_1959 | -49 | 6.3 | GTGTACTAGTTGTAGTAATACAC |
| Lactobacillus rhamnosus GG | LGG_02246 | -46 | 6.7 | GTGTACTGCGTATAATAGTACAC |
| Lactobacillus sakei subsp. sakei 23K | LSA1419 | -61 | 6.8 | GTGTACTACGTATAATAGTACAG |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_0050 | -123 | 6.6 | GTGTACTGTGTATTATAGTACAC |