Propagation of YtrA regulog to Lactobacillus rhamnosus HN001

Reference regulog properties
Source regulog:	YtrA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus rhamnosus HN001
Orthologous TF(s)	LRH_08648
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Lactobacillus rhamnosus HN001*
	Locus tag	Position	Score	Sequence
Position: -46 Score: 6.7 Sequence: GTGTACTGCGTATAATAGTACAC Locus tag: LRH_08648
	LRH_08648	-46	6.7	GTGTACTGCGTATAATAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Predicted transcriptional regulator, GntR family
Lactobacillus brevis ATCC 367	LVIS_0408	-60	6.7	GTGTACTAGGTATAATAGTACAG
Lactobacillus plantarum WCFS1	lp_1959	-49	6.3	GTGTACTAGTTGTAGTAATACAC
Lactobacillus rhamnosus GG	LGG_02246	-46	6.7	GTGTACTGCGTATAATAGTACAC
Lactobacillus sakei subsp. sakei 23K	LSA1419	-61	6.8	GTGTACTACGTATAATAGTACAG
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0050	-123	6.6	GTGTACTGTGTATTATAGTACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --