Propagation of MalR3 regulog to Lactobacillus rhamnosus HN001

Reference regulog properties
Source regulog:	MalR3 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus rhamnosus HN001
Orthologous TF(s)	LRH_00697
Regulated genes	1

Built upon 17 sites [see more]

Predicted regulatory interactions in *Lactobacillus rhamnosus HN001*
	Locus tag	Position	Score	Sequence
Position: -226 Score: 6.4 Sequence: TTAAGCAAACGTTTGCGTAA Locus tag: LRH_00687
	LRH_00687	-226	6.4	TTAAGCAAACGTTTGCGTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nplT
Ortholog function: Neopullulanase (EC 3.2.1.135)
Lactobacillus fermentum IFO 3956	LAF_0739	-56	6	TTACTCAAACGTTTGCGTAA
Lactobacillus plantarum WCFS1	lp_3627	-52	6.3	TTAAGCAAACGTTTGCTTAA
Lactobacillus reuteri JCM 1112	LAR_0078	-69	6.1	TTAAGTAAACGTTTACATTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --