Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YxeR regulog to Lactobacillus crispatus ST1

Reference regulog properties
Source regulog: YxeR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus crispatus ST1
Orthologous TF(s) LCRIS_01869
Regulated genes 1
Built upon 20 sites [see more]
Predicted regulatory interactions in Lactobacillus crispatus ST1
Locus tag Position Score Sequence
Position: -44
Score: 4.3
Sequence: TTGATGACAAGTCGTCATTTG
Locus tag: LCRIS_01869
LCRIS_01869 -44 4.3 TTGATGACAAGTCGTCATTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yxeR
Ortholog function: Predicted antibiotic resistance transcriptional reguator, TetR family
Lactobacillus acidophilus NCFM LBA1840 -81 3.6 TTATTGACAACTCGTCACAAT
Lactobacillus helveticus DPC 4571 lhv_1880 -80 4.5 GTATTGACAATGCGTCACAAA
© 2009-2020 RegPrecise