Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MdxR regulog to Lactobacillus crispatus ST1

Reference regulog properties
Source regulog: MdxR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus crispatus ST1
Orthologous TF(s) LCRIS_01900
Regulated genes 2
Built upon 11 sites [see more]
Predicted regulatory interactions in Lactobacillus crispatus ST1
Locus tag Position Score Sequence
Position: -79
Score: 5.5
Sequence: TTTTGATACCGCTAACAATA
Locus tag: LCRIS_01897
LCRIS_01897 -79 5.5 TTTTGATACCGCTAACAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malL
Ortholog function: Oligo-1,6-glucosidase (EC 3.2.1.10)
Lactobacillus acidophilus NCFM LBA1872 -78 5.4 TTTTGATACCGCTAACATCT
Lactobacillus casei ATCC 334 LSEI_0980 -82 5.4 TTTTGATAACGGTAACAAAC
Lactobacillus helveticus DPC 4571 lhv_2002 -63 5.6 TTTTGATACCGGTAACATCC
Lactobacillus johnsonii NCC 533 LJ0211 -81 5.5 TTTTGATACCGGTAACAGAT