Propagation of AguR regulog to Lactobacillus sakei subsp. sakei 23K

Reference regulog properties
Source regulog:	AguR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:
Biological process:	Agmatine utilization
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus sakei subsp. sakei 23K
Orthologous TF(s)	LSA0073
Regulated genes	1

Built upon 3 sites [see more]

Predicted regulatory interactions in *Lactobacillus sakei subsp. sakei 23K*
	Locus tag	Position	Score	Sequence
Position: -121 Score: 4.8 Sequence: AAATGGAACAAAATACACAT Locus tag: LSA0067
	LSA0067	-121	4.8	AAATGGAACAAAATACACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ptcA
Ortholog function: Putrescine carbamoyltransferase (EC 2.1.3.6)
Lactobacillus brevis ATCC 367	LVIS_2210	-157	5.6	GAATGAAACATGTGTCACCA
Lactobacillus sakei subsp. sakei 23K	LSA0067	-121	4.8	AAATGGAACAAAATACACAT
Pediococcus pentosaceus ATCC 25745	PEPE_0189	-145	6.2	AAATGAAACATGTTTCATGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --