Propagation of BusR regulog to Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Reference regulog properties
Source regulog:	BusR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Betaine utilization
Effector:	Betaine
Phylum:	Firmicutes
Propagated regulon:
Target genome	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Orthologous TF(s)	LEUM_0356
Regulated genes	2

Built upon 2 sites [see more]

Predicted regulatory interactions in *Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293*
	Locus tag	Position	Score	Sequence
Position: -103 Score: 7.7 Sequence: AGTGACAACCTATACTTTATAACAAGTTGTCTCT Locus tag: LEUM_0356
	LEUM_0356	-103	7.7	AGTGACAACCTATACTTTATAACAAGTTGTCTCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: busR
Ortholog function: Betaine utilization transcriptional regulator BusR, GntR family
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0356	-103	7.7	AGTGACAACCTATACTTTATAACAAGTTGTCTCT

Position: -146 Score: 7.7 Sequence: AGAGACAACTTGTTATAAAGTATAGGTTGTCACT Locus tag: LEUM_0357
	LEUM_0357	-146	7.7	AGAGACAACTTGTTATAAAGTATAGGTTGTCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: busA
Ortholog function: Glycine betaine ABC transporter, ATP-binding protein
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0357	-146	7.7	AGAGACAACTTGTTATAAAGTATAGGTTGTCACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --