Propagation of CelR regulog to Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Reference regulog properties
Source regulog:	CelR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Orthologous TF(s)	LEUM_0929
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293*
	Locus tag	Position	Score	Sequence
Position: -83 Score: 6.8 Sequence: TTTCCGCAAGTATGAGGAAA Locus tag: LEUM_0927
	LEUM_0927	-83	6.8	TTTCCGCAAGTATGAGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglA
Ortholog function: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0927	-83	6.8	TTTCCGCAAGTATGAGGAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --