Propagation of RbsR regulog to Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Reference regulog properties
Source regulog:	RbsR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Orthologous TF(s)	LEUM_0795
Regulated genes	2

Built upon 18 sites [see more]

Predicted regulatory interactions in *Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293*
	Locus tag	Position	Score	Sequence
Position: -46 Score: 6.6 Sequence: TTAGTAAAACGTTTAACCAA Locus tag: LEUM_0794
	LEUM_0794	-46	6.6	TTAGTAAAACGTTTAACCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbsK
Ortholog function: Ribokinase (EC 2.7.1.15)
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0794	-46	6.6	TTAGTAAAACGTTTAACCAA

Position: -123 Score: 6.6 Sequence: TTAGTAAAACGTTTAACCAA Locus tag: LEUM_0795
	LEUM_0795	-123	6.6	TTAGTAAAACGTTTAACCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbsR
Ortholog function: Transcriptional repressor of ribose utilization, LacI family
Lactobacillus casei ATCC 334	LSEI_0306	-45	6.7	TAAGTAAAACGTTTTACCTA
Lactobacillus fermentum IFO 3956	LAF_1343	-44	6	TTAGTAAACTGTTTTATTAA
Lactobacillus reuteri JCM 1112	LAR_1219	-35	4.7	TAGATAAAACTGTTTACTAA
Lactobacillus rhamnosus GG	LGG_00372	-46	6.7	TAAGTAAAACGTTTTACCTA
Lactobacillus sakei subsp. sakei 23K	LSA0203	-49	6.9	TTAGTAAAACGTTTTACTAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0795	-123	6.6	TTAGTAAAACGTTTAACCAA
Oenococcus oeni PSU-1	OEOE_0146	-47	5.1	TGTTGTAAACGTTTTAAGAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --