Propagation of MalR3 regulog to Oenococcus oeni PSU-1

Reference regulog properties
Source regulog:	MalR3 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Oenococcus oeni PSU-1
Orthologous TF(s)	OEOE_0042
Regulated genes	2

Built upon 17 sites [see more]

Predicted regulatory interactions in *Oenococcus oeni PSU-1*
	Locus tag	Position	Score	Sequence
Position: -59 Score: 6.1 Sequence: TTTTGTAAACGTTTACTTAA Locus tag: OEOE_0041
	OEOE_0041	-59	6.1	TTTTGTAAACGTTTACTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malT2
Ortholog function: Predicted maltose/maltodextrin permease
Lactobacillus brevis ATCC 367	LVIS_2179	-106	5.5	TTACACAAACGTTTGCTTTT
Lactobacillus plantarum WCFS1	lp_3533	-106	5.5	AAGTGTAAACGTTTACTTTA
		-74	5.8	TATTGTAAACGTTTACGTTA
Oenococcus oeni PSU-1	OEOE_0041	-59	6.1	TTTTGTAAACGTTTACTTAA

Position: -149 Score: 6.1 Sequence: TTAAGTAAACGTTTACAAAA Locus tag: OEOE_0042
	OEOE_0042	-149	6.1	TTAAGTAAACGTTTACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malR3
Ortholog function: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0829	-135	5.1	TACAGTAAACGTTTACTTAG
Oenococcus oeni PSU-1	OEOE_0042	-149	6.1	TTAAGTAAACGTTTACAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --