Propagation of YtrA regulog to Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Reference regulog properties
Source regulog:	YtrA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Orthologous TF(s)	LBUL_1589
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365*
	Locus tag	Position	Score	Sequence
Position: -50 Score: 6.7 Sequence: GTGTACTAGAATAAATAGTACAG Locus tag: LBUL_1589
	LBUL_1589	-50	6.7	GTGTACTAGAATAAATAGTACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Predicted transcriptional regulator, GntR family
Lactobacillus casei ATCC 334	LSEI_2244	-46	6.9	GTGTACTACGTATAATAGTACAC
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_1589	-50	6.7	GTGTACTAGAATAAATAGTACAG
Oenococcus oeni PSU-1	OEOE_1803	-45	6.6	CTGTACTAATTAATATAGTACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --